Tuesday, November 20, 2018

Error: Sorted input specified, but the file has the following out of order record with a different sort order than the genomeFile

This error troubled me a lot while parsing some data, at last this error is resolved for my case.

filename: test_genome_lengths:
KP5_Contig1    1099843
KP5_Contig2    939199
KP5_Contig3    804334
KP5_Contig4    704755
KP5_Contig5    490858
KP5_Contig6    445261
KP5_Contig7    336421
KP5_Contig8    205120
KP5_Contig9    173756
KP5_Contig10    63375
KP5_Contig11    4752

filename: original.bed
KP5_Contig1    2    378871
KP5_Contig1    378872    812978
KP5_Contig1    814316    1099843
KP5_Contig10    27093    28206
KP5_Contig10    30740    42583
KP5_Contig10    43383    46800
KP5_Contig10    47283    51877
KP5_Contig10    52485    57209
KP5_Contig10    57496    57838
KP5_Contig11    1    902
KP5_Contig11    3859    4197
KP5_Contig11    4429    4752
KP5_Contig2    1    939199
KP5_Contig3    1    8672

 bedtools complement -i original.bed -g test_genome_lengths

Error: Sorted input specified, but the file has the following out of order record with a different sort order than the genomeFile
KP5_Contig2    1    939199

This is caused because my bed file is not sorted numerically using sort. The correct order I needed to input was:

filename: corrected.bed
KP5_Contig1    2    378871
KP5_Contig1    378872    812978
KP5_Contig1    814316    1099843
KP5_Contig2    1    939199
KP5_Contig3    1    8672
KP5_Contig10    27093    28206
KP5_Contig10    30740    42583
KP5_Contig10    43383    46800
KP5_Contig10    47283    51877
KP5_Contig10    52485    57209
KP5_Contig10    57496    57838
KP5_Contig11    1    902
KP5_Contig11    3859    4197
KP5_Contig11    4429    4752

bedtools complement -i corrected.bed -g test_genome_lengths

Now, no error exists.

To get corrected.bed, I have sorted numerically in the following way:

cat original.bed | sort -n -k1.11 -nk2,2 >corrected.bed

For more info on this sort function, check this stack overflow post.

Thursday, September 27, 2018

Downloading fasta using efetch - CentOS


$ efetch -db nucleotide -id KJ413946.1 -format fasta


501 Protocol scheme 'https' is not supported (LWP::Protocol::https not installed)
No do_post output returned from 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=KJ413946.1&rettype=fasta&retmode=text&edirect_os=linux&edirect=9.90&tool=edirect&email=datta@ttshbio'
Result of do_post http request is
$VAR1 = bless( {
                 '_content' => 'LWP will support https URLs if the LWP::Protocol::https module
is installed.
',
                 '_rc' => 501,
                 '_headers' => bless( {
                                        'client-warning' => 'Internal response',
                                        'client-date' => 'Thu, 27 Sep 2018 06:42:06 GMT',
                                        'content-type' => 'text/plain',
                                        '::std_case' => {
                                                          'client-warning' => 'Client-Warning',
                                                          'client-date' => 'Client-Date'
                                                        }
                                      }, 'HTTP::Headers' ),
                 '_msg' => 'Protocol scheme \'https\' is not supported (LWP::Protocol::https not installed)',
                 '_request' => bless( {
                                        '_content' => 'db=nucleotide&id=KJ413946.1&rettype=fasta&retmode=text&edirect_os=linux&edirect=9.90&tool=edirect&email=datta@ttshbio',
                                        '_uri' => bless( do{\(my $o = 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi')}, 'URI::https' ),
                                        '_headers' => bless( {
                                                               'user-agent' => 'libwww-perl/6.05',
                                                               'content-type' => 'application/x-www-form-urlencoded'
                                                             }, 'HTTP::Headers' ),
                                        '_method' => 'POST'
                                      }, 'HTTP::Request' )
               }, 'HTTP::Response' );

Installing "perl-LWP-Protocol-https" has solved the problem!


$ sudo yum install perl-LWP-Protocol-https


$ efetch -db nucleotide -id KJ413946.1 -format fasta
>KJ413946.1 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence
ATGGCAGAGGAAAGCAAACAGCTAACCAAACGGCAACAAAAAGCCATTGATACAGCGGCGTTAATCCGGC
AGGAGCCGCCGCAGGGTGAAGATATGGCATTCACCCACTCCATTCTGTGCCAGGTCGGTTTGCCCCGTTC
TAAGGTGGCAGGGCGTGAGTTTATGCGCCGTTCTGGTGATGCCTGGCTCGTCGTACAGGCAGGCTGGATT
GATGAAGGCAGTGGCCCGGTAGAGCAGCCTTTACCCTATGGCGCTATGCCGCGACTCACGTTCGCCTGGA
TTTCATCGTATGCACTGCGCAACAAAACGCGGGAAATCGCCATCGGCCACAGCGCTAATGAGTTTCTTCA
CCTTATGGGGATGGACTCACAGGGAACCCGTCATAAAACGCTGCGTACACAAATGCAGGCGCTGGCCGCG
TGTCGTTTGCAGCTGGGCTTTAAGGGCC

For downloading multiple records from NCBI directly with a list of accession using "efetch" and make accession as filename:

$ time for d in $(cat Plasmid.list);do echo $d; efetch -db nucleotide -id $d -format fasta >$d.fasta; done ##takes a bit longer time 
 
real    6m47.812s
user    0m43.515s
sys    0m7.811s  

For extracting multiple records from local NT/NR database with a list of accessions using "blastdbcmd" and make accession as filename

$ time for d in $(cat Plasmid.list);do echo $d; blastdbcmd -db nt -entry $d >$d.fasta; done

real    0m26.736s
user    0m7.004s
sys    0m4.384s  

Notice the advantage of having downloaded local databases. It just took 26 secs!!

Wednesday, September 26, 2018

Cannot find xml2-config - R Studio - CentOS

Came across this error while installing CINNA package on CentOS.


checking for xml2-config... no

Cannot find xml2-config
ERROR: configuration failed for package ‘XML’
* removing ‘/home/datta/R/x86_64-redhat-linux-gnu-library/3.4/XML’
Warning in install.packages :
  installation of package ‘XML’ had non-zero exit status

On terminal:


$ sudo yum install libxml2-devel

Loaded plugins: fastestmirror, langpacks
Loading mirror speeds from cached hostfile 
 
 * base: centos.netonboard.com
 * epel: mirror.premi.st
 * extras: mirror.myren.net.my
 * ius: hkg.mirror.rackspace.com
 * nux-dextop: mirror.li.nux.ro
 * updates: centos.ipserverone.com

Resolving Dependencies
--> Running transaction check
---> Package libxml2-devel.x86_64 0:2.9.1-6.el7_2.3 will be installed
--> Finished Dependency Resolution

Dependencies Resolved
...................

Installed:
  libxml2-devel.x86_64 0:2.9.1-6.el7_2.3                                                                                                                                                                          
Complete!

then in R:

install.packages("XML")

This worked without error! 

Sunday, September 23, 2018

makeblastdb - Segmentation fault (core dumped)

I had a list of sequence which I wanted to use as NCBI BLAST database. makeblastdb (version 2.7.1+) was throwing me the following error!


$ grep '>' NCBI_PlasmidCluster_TophitsSeqs.fasta
 
>NZ_CM008903.1_Enterobacter_cloacae_strain_22ES_plasmid_p22ES-4970,_whole_genome_shotgun_sequence
>NZ_CM004622.1_Escherichia_coli_strain_Ec47VL_plasmid_pEC47a,_whole_genome_shotgun_sequence
>KC355363.1_Aeromonas_hydrophila_strain_AH1_plasmid_pN6,_partial_sequence
>HQ651092.1_Klebsiella_oxytoca_plasmid_pFP10-1_replication_protein_gene,_partial_cds;_hypothetical_protein_(pKP048_08),_antirestriction_protein_KlcA_(klcA),_hypothetical_protein_(pKP048_09),_transcriptional_repressor_protein_KorC_(korC),_putative_ISKpn6-like_transposase_(tnpA),_and_carbapenemase_KPC-2_(blaKPC-2)_genes,_complete_cds;_and_transposon_Tn3_truncated_TEM-beta-lactamase_(bla)_and_ISKpn8_transposase_(tnpA)_genes,_complete_cds,_insertion_sequence_ISKpn8,_complete_sequence,_and_TnpR_(tnpR)_gene,_partial_cds


$ makeblastdb -in NCBI_PlasmidCluster_TophitsSeqs.fasta -dbtype nucl -out NCBI_PlasmidCluster_TophitsSeqs.fasta.DB -parse_seqids

Building a new DB, current time: 09/24/2018 11:02:13
New DB name:   NCBI_PlasmidCluster_TophitsSeqs.fasta.DB
New DB title:  NCBI_PlasmidCluster_TophitsSeqs.fasta
Sequence type: Nucleotide
Keep MBits: T
Maximum  size: 1000000000B


CFastaReader: Near line 1, the sequence id string contains 'comma' symbol, which has been replaced with 'underscore' symbol. Please correct the sequence id string.
CFastaReader: Near line 74, the sequence id string contains 'comma' symbol, which has been replaced with 'underscore' symbol. Please correct the sequence id string.
CFastaReader: Near line 132, the sequence id string contains 'comma' symbol, which has been replaced with 'underscore' symbol. Please correct the sequence id string.
CFastaReader: Near line 298, the sequence id string contains 'comma' symbol, which has been replaced with 'underscore' symbol. Please correct the sequence id string.

Adding sequences from FASTA; added 4 sequences in 0.00256801 seconds.

Segmentation fault (core dumped)

Tried the following:

1) Let's remove comma's 


$ sed 's/,/_/g' NCBI_PlasmidCluster_TophitsSeqs.fasta >NCBI_PlasmidCluster_TophitsSeqs_1NoCommas.fasta

$ grep '>' NCBI_PlasmidCluster_TophitsSeqs_1NoCommas.fasta


>NZ_CM008903.1_Enterobacter_cloacae_strain_22ES_plasmid_p22ES-4970__whole_genome_shotgun_sequence
>NZ_CM004622.1_Escherichia_coli_strain_Ec47VL_plasmid_pEC47a__whole_genome_shotgun_sequence
>KC355363.1_Aeromonas_hydrophila_strain_AH1_plasmid_pN6__partial_sequence
>HQ651092.1_Klebsiella_oxytoca_plasmid_pFP10-1_replication_protein_gene__partial_cds;_hypothetical_protein_(pKP048_08)__antirestriction_protein_KlcA_(klcA)__hypothetical_protein_(pKP048_09)__transcriptional_repressor_protein_KorC_(korC)__putative_ISKpn6-like_transposase_(tnpA)__and_carbapenemase_KPC-2_(blaKPC-2)_genes__complete_cds;_and_transposon_Tn3_truncated_TEM-beta-lactamase_(bla)_and_ISKpn8_transposase_(tnpA)_genes__complete_cds__insertion_sequence_ISKpn8__complete_sequence__and_TnpR_(tnpR)_gene__partial_cds


$ makeblastdb -in NCBI_PlasmidCluster_TophitsSeqs_1NoCommas.fasta -dbtype nucl -out NCBI_PlasmidCluster_TophitsSeqs.fasta.DB -parse_seqids


Building a new DB, current time: 09/24/2018 11:08:16
New DB name:   NCBI_PlasmidCluster_TophitsSeqs.fasta.DB
New DB title:  NCBI_PlasmidCluster_TophitsSeqs_1NoCommas.fasta
Sequence type: Nucleotide
Keep MBits: T

Maximum  size: 1000000000B
Adding sequences from FASTA; added 4 sequences in 0.00210285 seconds.

Segmentation fault (core dumped)

2) Now let's try removing brackets in fasta headers


$ sed 's/[()]/_/g' NCBI_PlasmidCluster_TophitsSeqs_1NoCommas.fasta >NCBI_PlasmidCluster_TophitsSeqs_2NoBrackets.fasta


$ makeblastdb -in NCBI_PlasmidCluster_TophitsSeqs_2NoBrackets.fasta -dbtype nucl -out NCBI_PlasmidCluster_TophitsSeqs.fasta.DB -parse_seqids


Building a new DB, current time: 09/24/2018 11:11:39

New DB name:   NCBI_PlasmidCluster_TophitsSeqs.fasta.DB
New DB title:  NCBI_PlasmidCluster_TophitsSeqs_2NoBrackets.fasta
Sequence type: Nucleotide
Keep MBits: T
Maximum  size: 1000000000B 
Adding sequences from FASTA; added 4 sequences in 0.00201416 seconds.

Segmentation fault (core dumped)

3. Shorten the header - This has worked!!


$ cat NCBI_PlasmidCluster_TophitsSeqs_2NoBrackets.fasta | cut -f1 -d ";" >NCBI_PlasmidCluster_TophitsSeqs_3_Shortened.fasta


$ makeblastdb -in NCBI_PlasmidCluster_TophitsSeqs_3_Shortened.fasta -dbtype nucl -out NCBI_PlasmidCluster_TophitsSeqs.fasta.DB -parse_seqids



Building a new DB, current time: 09/24/2018 11:19:48

New DB name:   NCBI_PlasmidCluster_TophitsSeqs.fasta.DB
New DB title:  NCBI_PlasmidCluster_TophitsSeqs_3_Shortened.fasta
Sequence type: Nucleotide
Keep MBits: T
Maximum  size: 1000000000B

Adding sequences from FASTA; added 4 sequences in 0.00199008 seconds.


Appears like makeblastdb has a limit for the length for the headers in fasta. Should take note of it!

Wednesday, September 19, 2018

BLASTN Error: NCBI C++ Exception

Ran into this error today morning.


Error: NCBI C++ Exception:
    T0 "/home/coremake/release_build/build/PrepareRelease_Linux64-Centos_JSID_01_380670_130.14.18.6_9008__PrepareRelease_Linux64-Centos_1508370803/c++/compilers/unix/../../src/serial/objistrasnb.cpp", line 179: Error: ncbi::CObjectIStreamAsnBinary::UnexpectedTagClassByte() - byte 0: unexpected tag: application/constructed/11 (107), should be constructed/None (32) ( at Blast-def-line-set[])


Found that incomplete or corrupted database causes this problem. I had two copies of the same NT database, so I ran md5sum for each of the file in the database and found the md5sum of one of the file was not same. (see below)

 
the long string above is md5sum,file name. - Note the md5sums of the same file are not same.

So just copied the nt.00.nhr file from the archive and blast worked without trouble. If not, you have to download the database again or run makeblastdb again on the fasta sequences.

Sunday, August 26, 2018

Matching alphanumeric string in PERL

 
if($_ =~ /[a-zA-Z]+/ && $_ =~ /[0-9]+/)


$_ : the string in default variable
=~ : should match
a-zA-Z: lower case and uppercase
+ : more than once
&&: as well as
0-9: numbers

Connection timed out; no servers could be reached - CentOS - Solved

For some reason, could not connect access internet in CentOS, although my network shows connected. 
$ nslookup google.com
;; connection timed out; no servers could be reached
 
$ ping www.google.com
ping: www.google.com: Name or service not known

$ ping 8.8.8.8

From XX.XX.X.X icmp_seq=1 Destination Net Unreachable
From XX.XX.X.X icmp_seq=2 Destination Net Unreachable
From XX.XX.X.X icmp_seq=3 Destination Net Unreachable
From XX.XX.X.X icmp_seq=4 Destination Net Unreachable
 
then, from an online post, I understand that /etc/sysconfig/network should have following:  
$ cat /etc/sysconfig/network
NETWORKING=yes
 
When I checked my /etc/sysconfig/network, it was empty. Soon, I updated it with   
NETWORKING=yes 
GATEWAY=XX.XX.X.X (filled with my IP address)
and restarted my system again, which works now without problem!! 
$ ping 8.8.8.8
PING 8.8.8.8 (8.8.8.8) 56(84) bytes of data.
64 bytes from 8.8.8.8: icmp_seq=1 ttl=117 time=27.6 ms
64 bytes from 8.8.8.8: icmp_seq=2 ttl=117 time=39.6 ms
64 bytes from 8.8.8.8: icmp_seq=3 ttl=117 time=29.8 ms
64 bytes from 8.8.8.8: icmp_seq=4 ttl=117 time=62.9 ms
64 bytes from 8.8.8.8: icmp_seq=5 ttl=117 time=35.4 ms
64 bytes from 8.8.8.8: icmp_seq=6 ttl=117 time=18.7 ms
^C
--- 8.8.8.8 ping statistics ---
6 packets transmitted, 6 received, 0% packet loss, time 5009ms

Wednesday, August 22, 2018

Sunday, August 19, 2018

Gene Ontology information from Uniport IDs


1) Go to https://www.uniprot.org/uploadlists/, paste your identifiers and submit



2) Once you get results, click Gene Ontology on the left side to gene ontology annotations.




 3) Check the results by clicking the "+" button. Once it expands you can see more details




 4) Once it expands you can see more details like below:



Thursday, August 9, 2018

Generate combinations from a item list in BASH + Ignore same pairs

View the contents of the file using cat command

$ cat list
Pair1
Pair2
Pair3
Pair4

A bash "for" loop in another "for" helps + AWK resolves the issue

$ for d in $(cat list); do for i in $(cat list); do echo "$d $i"; done done | awk '$1 != $2'

Pair1 Pair2
Pair1 Pair3
Pair1 Pair4
Pair2 Pair1
Pair2 Pair3
Pair2 Pair4
Pair3 Pair1
Pair3 Pair2
Pair3 Pair4
Pair4 Pair1
Pair4 Pair2
Pair4 Pair3

Sequence lengths from AWK one-liner


$ awk '/^>/ {if (sqlen){print sqlen}; print ;sqlen=0;next; } { sqlen = sqlen +length($0)}END{print sqlen}' db4_cdc_NDM_only.fasta | sed 's/>//g' | paste - - 

ref|NZ_CP029245.1| Escherichia_coli_strain_ECCRA-119_plasmid_pTB203,_complete_sequence 46161
ref|NZ_CP029386.1| Klebsiella_pneumoniae_subsp._pneumoniae_strain_SCKP040074_plasmid_pNDM6_040074,_complete_sequence 52989
ref|NZ_CP029731.1| Citrobacter_sp._CRE-46_strain_AR_0157_plasmid_unnamed3,_complete_sequence 108148
ref|NZ_CP029737.1| Providencia_rettgeri_strain_AR_0082_plasmid_unnamed,_complete_sequence 144970
ref|NZ_CP029978.1| Escherichia_coli_strain_51008369SK1_plasmid_p51008369SK1_E,_complete_sequence 99465
ref|NZ_KM923969.1| Acinetobacter_dijkshoorniae_strain_JVAP01_plasmid_pNDM-JVAP01,_complete_sequence 47268

Friday, August 3, 2018

Setting up AWS CLI and Downloading S3 Files using command line interface

1. Install the AWS Command Line Interface (CLI) using:

$ pip install awscli 


For more details such as upgrade, check the amazon webpage here.

Note: if installation was not successful, reinstall forcefully. Check here

The next step is to configure. AWS requires the following items for this:
(how to find these?)
  1. Access key ID
  2. Secret Access key
  3. Region name
  4. Valid output format
2. Configuration

Now, run the following command and answer the prompts:

$ aws configure
 
AWS Access Key ID [None]: <enter the access key>
AWS Secret Access Key [None]: <enter the secret access key>
Default region name [None]: <enter region>
Default output format [None]: <text>


3. Copying files from AWS S3 folder to Local Desktop 

once this is done, we can start using AWS CLI for the file operations. For example, if it want to copy WBB3097.gz file in my AWS account to my local desktop, which is under "qgen" username and in the folder MIX7341, I do the following

$ aws s3 cp s3:URI  <Local Desktop Location>

$ aws s3 cp s3://qgen/MIX7341/WBB3097.gz ~/Desktop/AWS

4. List all files in AWS S3 folder 

Similarly to list all the files in the MIX7341, we can use the following command


$ aws s3 ls s3://qgen/MIX7341/

2018-08-02 11:03:58  459407360 WBB3066.gz
2018-08-02 11:03:01  337848320 WBB3067.gz
2018-08-02 11:02:57  327219200 WBB3068.gz
2018-08-02 11:02:57  298680320 WBB3069.gz
2018-08-02 11:02:57  280514560 WBB3070.gz

5. Copy multiple files using BASH for loop

Off hand, I had to download multiple files from AWS account. To click each file and download was taking time. So, I just listed the files (step1 below) and used "for loop" in bash to download the files (step2 below).


$ aws s3 ls s3://qgen/MIX7341/ | awk '{print $NF}' >files_in_AWS.list ##step 1

$ for d in $(cat files_in_AWS.list); do echo $d; aws s3 cp s3://qgen/MIX7341/$d . ; done ##step 2




border:solid green;border-width:.1em .1em .1em .8em;padding:.2em .6em;
Python ; Pastie ; www. hilitie.me

Thursday, August 2, 2018

ImportError: No module named botocore.session - Solved

My aws cli had some installation problems and ended up using the following error


$ aws

Traceback (most recent call last):

  File "/usr/bin/aws", line 19, in <module>

    import awscli.clidriver

  File "/usr/lib/python2.7/site-packages/awscli/clidriver.py", line 17, in <module>

    import botocore.session

ImportError: No module named botocore.session

Running the following command fixed the problem:


$ sudo pip install awscli --force-reinstall --upgrade

Collecting awscli

  Using cached https://files.pythonhosted.org/packages/18/99/a1a1ea5a91161d5be5f434550ac1de800d79da7d4f68a5b5c8f265fcbd58/awscli-1.15.70-py2.py3-none-any.whl

Collecting s3transfer<0.2.0,>=0.1.12 (from awscli)

  Using cached https://files.pythonhosted.org/packages/d7/14/2a0004d487464d120c9fb85313a75cd3d71a7506955be458eebfe19a6b1d/s3transfer-0.1.13-py2.py3-none-any.whl

Collecting colorama<=0.3.9,>=0.2.5 (from awscli)

  Using cached https://files.pythonhosted.org/packages/db/c8/7dcf9dbcb22429512708fe3a547f8b6101c0d02137acbd892505aee57adf/colorama-0.3.9-py2.py3-none-any.whl

Collecting rsa<=3.5.0,>=3.1.2 (from awscli)

  Using cached https://files.pythonhosted.org/packages/e1/ae/baedc9cb175552e95f3395c43055a6a5e125ae4d48a1d7a924baca83e92e/rsa-3.4.2-py2.py3-none-any.whl

Collecting docutils>=0.10 (from awscli)

  Using cached https://files.pythonhosted.org/packages/50/09/c53398e0005b11f7ffb27b7aa720c617aba53be4fb4f4f3f06b9b5c60f28/docutils-0.14-py2-none-any.whl

Collecting PyYAML<=3.13,>=3.10 (from awscli)

  Downloading https://files.pythonhosted.org/packages/9e/a3/1d13970c3f36777c583f136c136f804d70f500168edc1edea6daa7200769/PyYAML-3.13.tar.gz (270kB)

    100% |████████████████████████████████| 276kB 2.8MB/s

Collecting botocore==1.10.69 (from awscli)

  Using cached https://files.pythonhosted.org/packages/45/f3/0e5006bc6198213b853ca3975c537335a91716ffa1ed768e2b2ffe12d7ed/botocore-1.10.69-py2.py3-none-any.whl

Collecting futures<4.0.0,>=2.2.0; python_version == "2.6" or python_version == "2.7" (from s3transfer<0.2.0,>=0.1.12->awscli)

  Using cached https://files.pythonhosted.org/packages/2d/99/b2c4e9d5a30f6471e410a146232b4118e697fa3ffc06d6a65efde84debd0/futures-3.2.0-py2-none-any.whl

Collecting pyasn1>=0.1.3 (from rsa<=3.5.0,>=3.1.2->awscli)

  Downloading https://files.pythonhosted.org/packages/d1/a1/7790cc85db38daa874f6a2e6308131b9953feb1367f2ae2d1123bb93a9f5/pyasn1-0.4.4-py2.py3-none-any.whl (72kB)

    100% |████████████████████████████████| 81kB 3.5MB/s

Collecting jmespath<1.0.0,>=0.7.1 (from botocore==1.10.69->awscli)

  Using cached https://files.pythonhosted.org/packages/b7/31/05c8d001f7f87f0f07289a5fc0fc3832e9a57f2dbd4d3b0fee70e0d51365/jmespath-0.9.3-py2.py3-none-any.whl

Collecting python-dateutil<3.0.0,>=2.1; python_version >= "2.7" (from botocore==1.10.69->awscli)

  Using cached https://files.pythonhosted.org/packages/cf/f5/af2b09c957ace60dcfac112b669c45c8c97e32f94aa8b56da4c6d1682825/python_dateutil-2.7.3-py2.py3-none-any.whl

Collecting six>=1.5 (from python-dateutil<3.0.0,>=2.1; python_version >= "2.7"->botocore==1.10.69->awscli)

  Using cached https://files.pythonhosted.org/packages/67/4b/141a581104b1f6397bfa78ac9d43d8ad29a7ca43ea90a2d863fe3056e86a/six-1.11.0-py2.py3-none-any.whl

Building wheels for collected packages: PyYAML

  Running setup.py bdist_wheel for PyYAML ... done

  Stored in directory: /root/.cache/pip/wheels/ad/da/0c/74eb680767247273e2cf2723482cb9c924fe70af57c334513f

Successfully built PyYAML

ipaclient 4.5.4 requires jinja2, which is not installed.

rtslib-fb 2.1.63 has requirement pyudev>=0.16.1, but you'll have pyudev 0.15 which is incompatible.

ipapython 4.5.4 has requirement dnspython>=1.15, but you'll have dnspython 1.12.0 which is incompatible.

Installing collected packages: futures, jmespath, docutils, six, python-dateutil, botocore, s3transfer, colorama, pyasn1, rsa, PyYAML, awscli

  Found existing installation: futures 3.2.0

    Uninstalling futures-3.2.0:

      Successfully uninstalled futures-3.2.0

  Found existing installation: jmespath 0.9.3

    Uninstalling jmespath-0.9.3:

      Successfully uninstalled jmespath-0.9.3

  Found existing installation: docutils 0.14

    Uninstalling docutils-0.14:

      Successfully uninstalled docutils-0.14

  Found existing installation: six 1.9.0

    Uninstalling six-1.9.0:

      Successfully uninstalled six-1.9.0

  Found existing installation: python-dateutil 2.7.3

    Uninstalling python-dateutil-2.7.3:

      Successfully uninstalled python-dateutil-2.7.3

  Found existing installation: botocore 1.10.69

    Uninstalling botocore-1.10.69:

      Successfully uninstalled botocore-1.10.69

  Found existing installation: s3transfer 0.1.13

    Uninstalling s3transfer-0.1.13:

      Successfully uninstalled s3transfer-0.1.13

  Found existing installation: colorama 0.3.9

    Uninstalling colorama-0.3.9:

      Successfully uninstalled colorama-0.3.9

  Found existing installation: pyasn1 0.1.9

    Uninstalling pyasn1-0.1.9:

      Successfully uninstalled pyasn1-0.1.9

  Found existing installation: rsa 3.4.2

    Uninstalling rsa-3.4.2:

      Successfully uninstalled rsa-3.4.2

  Found existing installation: PyYAML 3.10

Cannot uninstall 'PyYAML'. It is a distutils installed project and thus we cannot accurately determine which files belong to it which would lead to only a partial uninstall.

You are using pip version 10.0.1, however version 18.0 is available.

You should consider upgrading via the 'pip install --upgrade pip' command.

 

$ aws
usage: aws [options] <command> <subcommand> [<subcommand> ...] [parameters]

To see help text, you can run:


  aws help

  aws <command> help

  aws <command> <subcommand> help

aws: error: too few arguments

 

We can check  aws version as following:


$ aws --version

aws-cli/1.15.70 Python/2.7.5 Linux/3.10.0-693.17.1.el7.x86_64 botocore/1.10.69
 

Thats it ! We can now use AWS CLI to access the buckets in our AWS console account. :)


Tuesday, July 10, 2018

IndexError: string index out of range - Parsnp - Solved

$ parsnp_linux_ignoresize -r ecoli_NZ_CP027462.fasta -d . -o coregenome -x -c
|--Parsnp v1.2--|
For detailed documentation please see --> http://harvest.readthedocs.org/en/latest
***************************
SETTINGS:
|-refgenome:    /storage/data/DATA4/analysis/Datta/CRE_outbreak/Trees/Parnsp_Gubbins_Concordant_Samples/CRE_Paola-GIS/ecoli_gte1kbContigs/ecoli_NZ_CP027462.fasta
|-aligner:    libMUSCLE
|-seqdir:    .
|-outdir:    coregenome
|-OS:        Linux
|-threads:    32
***************************

<<Parsnp started>>

-->Reading Genome (asm, fasta) files from ...
  |->[OK]
-->Reading Genbank file(s) for reference (.gbk) ..
  |->[WARNING]: no genbank file provided for reference annotations, skipping..
Traceback (most recent call last):
  File "<string>", line 656, in <module>
IndexError: string index out of range

Solution: a previous failed run generated empty parsnp.fasta file which led to this error. By deleting parsnp.fasta fixed the script run again.

Wednesday, June 20, 2018

Mutation rate to Substitution per site per genome per year

Converting date to fractional date for BEAST phylogenetic analysis software

While running BEAST, we need to generate an xml with the parameters. When we import the alignment file into BEAUti software and we require the sampling time in fractional years. Here is one way to do that in the excel. Regardless of your date is in any of the formats, the formula would convert that into a fractional year.


=YEAR(A1)+((A1)-DATE(YEAR(A1),1,0))/(DATE(YEAR(A1)+1,1,0)-DATE(YEAR(A1),1,0))


Tuesday, February 13, 2018

Merged entries in the non-redundant Nucleotide (nt) database

I ran the following command for to extract a sequence from nt database:


$ blastdbcmd -db /mnt/Storage/nt/nt/nt -entry KJ413946.1 | grep '>'

>KJ413946.1 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence >KP900017.1 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-NDM, complete sequence

I noticed that this is a merged entry in the 'non-redundant' Nucleotide (nt) database, where two nucleotide sequences which have the same sequence are combined under a single FASTA entry.

When I used the second identifier in the merged entry, blastdbcmd command gave me the same result in return:

$ blastdbcmd -db /mnt/Storage/nt/nt/nt -entry KP900017.1 | grep '>'

>KJ413946.1 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence >KP900017.1 Raoultella ornithinolytica strain YNKP001 plasmid pYNKP001-NDM, complete sequence

Curious to know, I checked if they are the same length. Yes they are of same length (41190).


$ blastdbcmd -db /mnt/Storage/nt/nt/nt -entry KP900017.1 | grep -v '>' | tr -d '\n' | wc 

      0       1   41190

$ blastdbcmd -db /mnt/Storage/nt/nt/nt -entry KJ413946.1 | grep -v '>' | tr -d '\n' | wc

      0       1   41190

Again curious to know,  if these two sequences are sharing an exact similarity match, I blasted both of them. And with no surprise, they share 100 % identity. See blast screenshots below:





So, how to sort this out? I need only one annotation instead of multiple for my analysis and do not want the second identifier to confuse my downstream analysis scripts.

By searching around, problem could solved by using  "-target_only"  option while running the command. I believe this situation might arise in nr database too but switching this on should help to achieve the purpose.


$ blastdbcmd -db /mnt/Storage/nt/nt/nt -entry KJ413946.1 -target_only | grep '>'

>KJ413946.1 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence